← API reference
Sequence analysis

IgBLAST API

Identify germline V(D)J matches in an antibody sequence.

Builds a FASTA query and invokes NCBI IgBLAST against the installed germline databases.

Web form Documentation ↗ Home page ↗ Source code ↗
Submit POST /api/igblast/

Queues a run and returns 202 with the job.

Schema GET /api/igblast/

Returns this tool's metadata and the fields below, as JSON.

Runtime

IgBLAST executable and germline databases installed by setup_system.sh · Executable · Moderate (s)

License

Permissive. Public domain: a US Government work from NCBI, with no copyright asserted and no restriction on commercial use. The IMGT-derived germline sets carry their own attribution terms.

Request body

Fields

The same names the web form posts. See the field type table for what each kind means over HTTP.

Name Type Required Default Description
query_name string text no antibody-query Query name
sequence_type string select no nucleotide Sequence type One of: nucleotide, protein.
sequence string textarea yes CAGGTGCAGCTGGTGCAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCT Sequence
organism string select no human Organism Selects the internal annotation data; match it to the databases below. One of: human, mouse, rat, rabbit, rhesus_monkey.
germline_db_v string select no — Germline V database BLAST databases found under the configured germline root. One of: (empty).
germline_db_d string select no — Germline D database BLAST databases found under the configured germline root. One of: (empty).
germline_db_j string select no — Germline J database BLAST databases found under the configured germline root. One of: (empty).
domain_system string select no imgt Domain system One of: imgt, kabat.
num_alignments number number no 5 Alignments to report minimum 1, maximum 100.
Example

A request that runs

These are the defaults, exactly as the web form would post them.

curl -X POST https://www.athanortools.com/api/igblast/ \
  -H 'Content-Type: application/json' \
  -d '{
  "query_name": "antibody-query",
  "sequence_type": "nucleotide",
  "sequence": "CAGGTGCAGCTGGTGCAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCT",
  "organism": "human",
  "germline_db_v": "",
  "germline_db_d": "",
  "germline_db_j": "",
  "domain_system": "imgt",
  "num_alignments": 5
}'

The reply is 202 with a queued job; poll its status_url until status is succeeded or failed. See the quick start for the whole exchange.

Responses

What comes back

statusMeaning
queued Accepted, waiting for the jobs ahead of it. `position` counts how many those are.
running The tool is executing now.
succeeded Finished; `result` holds the tool's output and `license` the terms it came under.
failed Finished; `error` holds a code and a message.

Errors

codeMeaning
invalid_input The client supplied invalid or incomplete input.
tool_unavailable The requested third-party dependency is not available on this host.
execution_failed A configured third-party process exited unsuccessfully.
internal_error An adapter failed in a way it does not describe. The detail is in the server log, not the response.
not_found No job has that id. Finished jobs are dropped eventually.